Özgün Araştırma

Muğla Yöresinde Köpek Visseral Leishmaniasis’in Moleküler ve Serolojik Prevalansı

10.4274/tpd.galenos.2020.7010

  • Serkan Bakırcı
  • Ali Dinç Topçuoğlu

Gönderim Tarihi: 09.06.2020 Kabul Tarihi: 11.08.2020 Turkiye Parazitol Derg 2021;45(1):11-16

Amaç:

Bu çalışmanın amacı, Muğla yöresindeki veteriner kliniklerine getirilen sahipli köpeklerde köpek visseral leishmaniasis’in prevalansının moleküler ve serolojik tekniklerle belirlenmesidir.

Yöntemler:

Çalışmanın materyali, Muğla yöresinde Ekim 2017-Kasım 2018 tarihleri arasında veteriner kliniklerine getirilen farklı ırk ve cinsiyetteki sahipli köpeklerden alınan kan örneklerinden oluşmaktadır. Toplam 131 köpekten alınan kan örnekleri, immünofloresan antikor testi (IFAT) ve polimeraz zincir reaksiyonu (PZR) ile analiz edilmiştir.

Bulgular:

Çalışmanın sonunda; IFAT sonuçlarına göre, 131 köpeğin 49’unda (%37,4) seropozitif olarak kabul edilen 1/64 ve üzeri titrelerde anti-Leishmania antikorları bulunmuştur. Diğer taraftan, bu çalışmada elde edilen PZR sonuçları, 131 köpeğin 9’unun (%6,87) RV1/RV2 PZR ile Leishmania spp. pozitif olduğunu göstermiştir.

Sonuç:

Sonuç olarak, Muğla yöresindeki köpekler için de bu hastalığın kontrol altına alınmasına yönelik tedbirlerin alınması ve vektör olan Phlebotom’lar ile mücadele ve kontrol programlarının geliştirilmesi konularının üzerinde daha ciddi durulması gerektiği önerilmektedir.

Anahtar Kelimeler: Köpek, Leishmania, Muğla, prevalans

GİRİŞ

Leishmaniasis, zorunlu hücre içi protozoon olan Leishmania cinsindeki türlerin neden olduğu zoonotik karakterli, visseral (VL), kutanöz (KL) ve mukozal (MKL) enfeksiyonlara sebebiyet verdiği ve farklı klinik belirtilerle kendini gösteren hastalıkların genel adlandırılmasıdır (1-4). Dünya çapında yaklaşık 50.000 ile 90.000 arasında yeni VL olgusu meydana gelmektedir ve 2018 yılı itibarı ile Dünya Sağlık Örgütü’ne bildirilen yeni olguların %95’inden fazlası Brezilya, Çin, Etiyopya, Hindistan, Irak, Kenya, Nepal, Somali, Güney Sudan ve Sudan’da ortaya çıkmıştır (5). Diğer taraftan, Dünya Sağlık Örgütü’ne göre, CL olgularının yaklaşık %95’i Amerika, Akdeniz havzası, Orta Doğu ve Orta Asya’da görülmüştür ve 2018’de yeni CL olgularının %85’inden fazlası; Afganistan, Cezayir, Bolivya, Brezilya, Kolombiya, İran, Irak, Pakistan, Suriye Arap Cumhuriyeti ve Tunus’tan bildirilmiştir. Dünyada da her yıl 600.000 ila 1 milyon arasında yeni olgu ortaya çıktığı tahmin edilmektedir. Yine Dünya Sağlık Örgütü’ne göre, MKL olgularının %90’ından fazlası Bolivya, Brezilya, Etiyopya ve Peru’da görülmektedir (5). Türkiye’nin leishmaniasisin epidemiyolojisinde önemli olan farklı ekolojik ve klimatik özelliklere sahip olduğu bilinmekte ve seyri ile coğrafi yayılışı yanında, zoonotik/antroponotik karakterli bir hastalık olması nedeniyle ayrı bir önem taşıdığına dikkat çekilmektedir (6). Köpek VL leishmaniasis Leishmania infantum’un (syn. Leishmania chagasi; Kinetoplastidae: Trypanosomatidae) neden olduğu, köpeklerin vektörlerle bulaşan en önemli hastalıklarından biri olarak kabul edilmektedir (2).

Klinik belirti gösteren VL'li enfekte köpeklerde; deri lezyonları, lenfadenopati, anemi, oküler lezyonlar, burun kanaması, topallık, iştahsızşık, kilo kaybı gibi bulgular görülmektedir (2,7,8). Bununla birlikte, hastalığın safhası, köpeklerin bağışıklık durumu ve hastalara uygulanan sağaltıma bağlı olarak klinik bulgular farklılık göstermekte, hatta enfekte köpeklerin 1/3’ünde herhangi bir bulguya rastlanılmamaktadır. Bu nedenlerle hastalığın klinik tanısının oldukça zor olduğu bildirilmektedir (9). Parazitin amastigot formlarının lenf yumrusu, kemik iliği veya dalak biopsisinde belirlenmesi güvenli bir tanı yöntemi olmakla birlikte, enfekte köpeklerin ancak %20-30’unda etken belirlenebilmektedir. Hastalıkta klinik bulguların değişken olması ve parazitin doğrudan belirlenmesindeki zorluklar nedeniyle kesin tanı, duyarlılık ve özgüllüğü yüksek serolojik testler [immünofloresan antikor testi (IFAT), ELISA] ve moleküler bir yöntem olan polimeraz zincir reaksiyonu (PZR) ile konulabilmektedir (2).

Bu çalışmada Muğla yöresindeki, veteriner kliniklerine getirilen sahipli köpeklerde Leishmania spp.’nin varlığının moleküler ve serolojik yöntemlerle araştırılması amaçlanmıştır. Bu amaçla köpeklerden kan alınması (antikoagülansız ve EDTA içeren antikoagülanlı tüpler kullanılarak), antikoagülansız tüplere alınan kanlardan serum çıkartılarak serolojik olarak IFAT ile değerlendirilmesi, EDTA içeren antikoagülanlı tüplere alınan kanlardan ise DNA izolasyonu yapılarak, DNA örneklerinde PZR yöntemi ile Leishmania spp.’ye özgü gen bölgelerinin tespitinin yapılması hedeflenmiştir.


YÖNTEMLER

Hasta Onay Belgesi ve Etik Kurul Onayı

Yürütülen bu çalışmada hasta sahiplerinden ayrı ayrı onam formları imzalı bir şekilde temin edilmiştir. Araştırmada, Etik Komite Onayı, Adnan Menderes Üniversitesi Hayvan Deneyleri Yerel Etik Kurulu Başkanlığı’ndan (28.09.2017 tarih ve 64583101/2017/107 no’lu) alınmıştır.

Çalışma Bölgesi ve Köpeklerin Seçimi

Bu çalışmada; leishmaniasis’in endemik olduğu Batı Ege Bölgesi’nde yer alan Muğla yöresindeki kliniklere getirilen sahipli klinik bulgu gösteren doğal enfekte ve/veya asemptomatik köpekler incelenmiştir. Araştırma, Ekim 2017-Kasım 2018 tarihleri arasında Muğla bölgesi merkez (n=38), ilçeleri; Marmaris (n=10), Datça (n=5), Köyceğiz (n=26), Ula (n=36), Ortaca (n=9), Milas (n=3), Yatağan (n=2), Fethiye (n=1) ve Kavaklıdere’den (n=1) sağlanan farklı ırk, 6 aylıktan büyük ve her iki cinsiyetten toplam 131 köpekte gerçekleştirilmiştir. Köpeklerin kan örneklerinin alındığı yerleşim alanları Şekil 1’de gösterilmiştir.

IFAT

IFA testinde antijen olarak lokal L. infantum (MON-1) stok promastigotları (Ege Üniversitesi Tıp Fakültesi, Parazitoloji Anabilim Dalı) kullanılmış ve test daha önce bildirildiği gibi gerçekleştirilmiştir (10). Bilinen pozitif ve negatif serum örnekleri kontrol olarak kullanılmıştır. Fluoresan işaretleme amacıyla ticari konjugat kullanılmıştır (FITC işaretli tavşan anti-dog IgG fluorescein isothiocyanate conjugate, sigma). Özetle; köpek serumları sulandırma plaklarında Fosfat tamponlu salin çözeltisi (PBS) ile 1/16, 1/32, 1/64, 1/128 ve üzeri oranlarında sulandırılmış ve her bir sulandırımdan 1 damla, lamların antijen kaplı yerlerine aktarılmıştır. Lamlar 37 oC’lik etüvde nemli kapalı kutularda 30 dakika tutulmuş ve süre sonunda PBS ile 3 kez 5’er dakika yıkanıp oda ısısında kurutulmuştur. FITC işaretli tavşan anti-dog IgG 1:200 oranında sulandırılarak kullanılmış ve lamların üzerinde çizilen her bir kuyucuğa bir damla konulmuştur. Lamlar tekrar 37 oC’lik etüvde nemli kapalı kutularda 30 dakika tutulmuş ve süre sonunda PBS ile 3 kez 5’er dakika yıkanmıştır. Lamlara, kurumadan kapatma solusyonu olan PBS-gliserin karışımından damlatılmış ve lamel ile kapatılmıştır. Lamlar, fluoresan mikroskobunda (Olympus, BX51) X 20 objektifte değerlendirilmiştir. Sulandırılan serum örneklerinde 1/64 ve üzeri dilusyonlar daha önceki çalışmada da olduğu gibi (2), pozitif kabul edilmiştir (Şekil 2).

PZR

Köpeklerden alınan kan örneklerinden DNA ekstraksiyonları için DNA Ekstraksiyon Kiti kullanılmış ve kit protokolüne göre DNA izolasyonu gerçekleştirilmiştir (Wizard Genomic DNA Purification Kit). Köpeklerden alınan kan örneklerinden izole edilen DNA’lar L. infantum/donovani kompleksine özgü primerler kullanılarak PZR ile çoğaltılmıştır. PZR’lerde, L. infantum/donovani kompleksinin kinetoplast DNA’sındaki LT1 fragmanından 145 bp’lik bir kısmı çoğaltmak için RV1 (5’ CTTTTCTGGTCCCGCGGGTAGG 3’) ve RV2 (5’ CCACCTGGCCTATTTTACACCA 3’) primerleri kullanılmıştır (11,12). Bu amaçla uygulanan PZR’de 25 µL’lik son hacimde, 10 mM Tris-HCL, pH 9,0, 1,5 mM MgCl2, 50 mM KCl, 200 µM dNTP/dUTP stoğu, 1,5 U Taq DNA polimeraz, 1 µM primer çifti ile 50 pmol DNA örneği kullanılmıştır. Reaksiyon termal sikluslu makinede (Applied Biosystems, Veriti™) gerçekleştirilmiştir. Reaksiyon 95 °C’de 12 dakikalık ön denatürasyonu takiben, 94 °C’de 50 saniyelik denatürasyon; 57 °C’de 50 saniye bağlanma; 72 °C’de 30 saniye uzamalardan oluşan 35 siklus ve 72 °C’de 10 dakikalık son uzama şeklinde uygulanmıştır. Daha sonra, 10 uL PZR ürünü, 1 saat boyunca 100 volt’ta Tris-asetat-EDTA (TAE) tamponu içerisinde 10 uL/mL Safe ViewTM ihtiva eden %3’lük agaroz jel üzerinde elektroforezlenmiş ve ultraviyole ışığı altında görüntülenmiştir (Şekil 3).

İstatistiksel Analiz

Çalışmada istatiksel analiz gerçekleştirilmemiş, ancak elde edilen veriler karşılaştırılmalı olarak tablolarda özetlenmeye çalışılmıştır.


BULGULAR

Muğla ilinden toplanan toplam 131 adet köpek serum örneklerinden 49’u (%37,4) serolojik olarak pozitif bulunmuştur. Pozitif örneklerin lokasyonları ve yüzde dağılımları Tablo 1’de özetlenmiştir. Çalışma bölgelerinde seropozitiflik oranı %0 ile %100 arasında değişkenlik göstermiştir. Datça ilçesinde karşılaşılan %80’lik seropozitivite sadece bir örnekle temsil edilen Fethiye ilçesi hariç tutulursa en yüksek seroprevalans gösteren bölge olarak dikkati çekmektedir. Datça ilçesindeki serolojik pozitiflik oranını sırasıyla; Ula (%47.22), Muğla/Merkez (%42,10), Marmaris (%30), Köyceğiz (%26,92) ve Ortaca (%11,11) takip etmektedir. Diğer taraftan, alınan toplam 131 örneğin moleküler incelemeleri sonucunda, dokuz örneğin (%6,87) PZR ile moleküler olarak pozitif olduğu belirlenmiştir. Pozitif bulunan köpeklerin üçer tanesi Köyceğiz ve Ula, birer tanesi ise sırasıyla; Ortaca, Muğla (Merkez) ve Marmaris ilçelerinden tespit edilmiştir. Bu örneklerden Ula ilçesindeki iki örnek ile Marmaris ve Muğla Merkez’den elde edilen birer örneklerin IFAT testi ile de pozitif olduğu belirlenirken kalan beş örneğin (3 Köyceğiz, 1 Ula ve 1 Ortaca) IFAT değerlendirmesinde negatif oldukları ortaya konmuştur. Analiz edilen örneklerin IFAT ve PZR ile karşılaştırmalı sonuçları Tablo 2’de özetlenmiştir.


TARTIŞMA

Yapılan çalışmalar ile dünyanın farklı bölgelerinde vahşi, evcil ve sinatropik memelilerin çeşitli türleri Leishmania spp.’nin konakları veya rezervuar konakları sayılmıştır. Kemirgenler, firavun fareleri, köpekler, kediler, tilkiler, çakallar, kurtlar, yarasalar, primat armadillolar ve diğer bazı evcil hayvanlar farklı yerlere leishmaniasis bulaşmasını sürdürmek için rezervuar konak görevi görmektedirler (13). Dünyanın pek çok Leishmania endemik bölgesinde, enfekte olmuş köpekler, VL ve KL Leishmaniasis’in insanlara zoonotik aktarımı için önemli bir rezervuar görevi görmektedir (14).

Endemik bölgelerde köpek VL leishmaniasisin prevalansı, o bölgedeki vektör popülasyonu, sıcaklık, nem gibi o bölgeye ait ekolojik şartlar ve rezervuar hayvanların popülasyonu ile direkt ilişkilidir (9). Günümüze kadar yapılan çalışmalarda Türkiye’de Phlebotomus cinsinin altında Phlebotomus, Adlerius, Larroussius, Paraphlebotomus, Transphlebotomus alt cinslerine ait 24 ve Sergentomyia cinsine dahil 4 dört türün bulunduğu, bunlardan yedi tanesinin, leishmaniasis enfeksiyonları açısından vektörlük yaptıkları bildirilmiştir (15-18). Köpek VL leishmaniasisin vektörlerinin belirlenmesine yönelik Ege Bölgesi’nin farklı illerinde gerçekleştirilen çalışmalardan birinde Denizli ilinde Phlebotomus cinsine bağlı sekiz farklı türün tespit edildiği, bunlardan köpek VL leishmaniaisin vektörlüğünü yaptığı bilinen P. neglectus’un en sık görülen tür olduğu belirtilmiştir (19). Batı Ege Bölgesi’ndeki Aydın ilinde yürütülen diğer bir çalışmada, 11 Phlebotomus, üç Sergentomyia türünün identifiye edildiği, burada da P. neglectus’un en baskın ikinci tür olduğu belirlenmiştir (15). Yapılan diğer bir çalışmada Muğla iline ait ilçeleri temsil eden kum sineği türleri arasında en dominant tür olarak %49.21 P. neglectus/syriacus tespit edilirken, bunu %17,77 ile P. tobbi’nin takip ettiği belirtilmiştir (20). Muğla ilindeki tüm kum sinekleri incelendiğinde en dominant tür olan P. neglectus/syriacus’un, Dünya Sağlık Örgütü tarafından VL leishmanias’isin etkeni olan L. infantum’un vektörü olduğu bildirilmiştir. Ülkemizde de KL ve VL leishmaniasis’e sebep olan L. infantum’un olası vektörleri arasında yer alan bu tür daha önce yapılan çalışmalarda başta Yunanistan, İtalya, Hırvatistan, Macaristan, Suriye, İsrail gibi ülkelerde sıklıkla tespit edilmiştir. Çalışma alanında %17,77 ile en dominant ikinci tür olan P. tobbi, Dünyada ve ülkemizde L. infantum’un kesin vektörü olarak bilinmektedir (21,22).

Köpek VL leishmaniasis için endemik sayılan Ege Bölgesi’nde hastalığın seroprevalansının ortaya konulması amacı ile gerçekleştirilen daha önceki çalışmalarda da köpeklerde %2,5 ile %23 arasında seropozitiflik belirlendiği tespit edilmiştir (2,9,19,23-27). Bu sonuçlar bu bölgede ortaya konan vektör popülasyon sonuçlarını da destekler niteliktedir (19). Bu çalışmada incelenen 131 köpekten 49’unda (%37,4) seropozitiflik ortaya konmuş olması, bölgede daha önce yapılan serolojik çalışmalarla örtüşmektedir. Diğer taraftan, Toz ve ark.’nın (28) yürüttüğü çalışmalarda Aydın ve İzmir illerindeki köpeklerde, daha önceden doğrulanmış olgulardan elde edilen kültürler ve örnekler üzerinden gerçekleştirilen moleküler tabanlı testlerde de L. infantum DNA’sının tespit edildiği belirtilmektedir (19). Aynı şekilde bu çalışmada değerlendirilen 131 köpekten dokuz tanesi (%6,87) PZR pozitif bulunmuştur. Bu çalışma neticesinde de hastalık için endemik sayılan Batı Ege Bölgesi’ndeki Muğla ilinde daha doğru epidemiyolojik veriler elde edildiği düşünülmektedir. Bu veriler doğrultusunda Batı Ege Bölgesi’ndeki köpek VL leishmaniasisin yaygınlığının belirlenmesinde, serolojik testlerin yanlış pozitiflik veya çapraz reaksiyonlar verebileceği göz önüne alınarak, moleküler testlerin kullanımının daha yararlı olacağı kanaatine varılmıştır.

Sonuç olarak, Batı Ege Bölgesi’ndeki köpeklerde gerek daha önceki çalışmalarda gerekse bu çalışma ile belirlenen VL leishmaniasisin hem insanlarda hem de hayvanlarda ciddi sağlık sorunları oluşturabileceğinden yola çıkılarak, rezervuar olan köpeklerde hastalığın kontrol altına alınmasına yönelik tedbirlerin ortaya konması, vektör olan Phlebotom’lar ile mücadele ve kontrol programlarının geliştirilmesi konularının üzerinde daha ciddi durulması gerektiği düşünülmektedir. Örneklemenin yapıldığı bölgelerdeki köpeklerin sahipli olmasına karşılık birçoğunda dış parazit uygulamalarının zamanında ve düzenli yapılmadığı tespit edilmiştir. Hastalığın bölgede endemik olarak bulunmasına karşın köpek sahiplerinin hastalık hakkında hiçbir bilgileri olmadığı da belirlenmiştir. Yeterli kontrol ve koruma tedbirlerinin alınmaması hastalığın bölgedeki hayvanlarda ve insanlarda bulaşma açısından tehlike arz etmeye devam etmesine sebep olmaktadır.


SONUÇ

Veteriner hekimlikte, Leishmania infantum’un sebep olduğu VL leishmaniasis özellikle köpeklerde önem arz etmektedir. Akdeniz ülkelerinde insanlarda görülen VL leishmaniasisin, doğadaki asıl rezervuarının, evcil ve yabani karnivorlar olduğu, aynı zamanda hastalığın bir bölgede endemik veya sporadik olgularla devam etmesinde bu hayvanların en önemli rolü oynadığı bildirilmiştir. Gelişmiş veya gelişmekte olan ülkelerde köpeklerin, insanların en önemli evcil hayvanlarından biri olması, gelişmekte olan ülkelerde başıboş köpek sayısının fazla olması, köpeklerin bu hastalık açısından ne kadar önemli olduğunu ortaya koymaktadır. Sürdürülebilir, etkili gözetim sistemleri ve salgınlar için hazırlık ve müdahale sistemleri dahil olmak üzere güncel yöntemler üretmek ve hastalık kontrol planları yapmak için ulusal leishmaniasis kontrol programlarının teknik ve finansal olarak desteklenmesi gerekmektedir. Hastalık eğilimlerinin izlenmesi ve leishmaniasis’in küresel yükü üzerinde farkındalık ve savunuculuk geliştirilmesine ve sağlık hizmetlerine eşit erişimin sağlanmasına yardımcı olacak kontrol faaliyetlerinin etkisinin değerlendirilmesi üzerinde durulmalıdır.

TEŞEKKÜR

Bu çalışma Aydın ADÜ Bilimsel Araştırma Projeleri Birimi tarafından VTF-170065 no’lu proje ile desteklenmiştir. Yazarlar ayrıca, teknik yardım ve malzemelerin temininde, makalenin eleştirel incelemelerinde katkı sunan Aydın Adnan Menderes Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Öğretim Üyeleri Tülin Karagenç ve Hüseyin Bilgin Bilgiç ile Arş. Gör. Dr. Metin Pekağırbaş’a teşekkür ederler.

* Etik

Etik Kurul Onayı: Araştırmada, Etik Komite Onayı, Adnan Menderes Üniversitesi Hayvan Deneyleri Yerel Etik Kurulu Başkanlığı’ndan (28.09.2017 tarih ve 64583101/2017/107 no’lu) alınmıştır.

Hasta Onayı: Bu çalışmada hasta sahiplerinden ayrı ayrı onam formları imzalı bir şekilde temin edilmiştir.

Hakem Değerlendirmesi: Editörler kurulundaki kişiler tarafından değerlendirilmiştir.

* Yazarlık Katkıları

Cerrahi ve Medikal Uygulama: S.B., A.D.T., Konsept: S.B., A.D.T., Dizayn: S.B., A.D.T., Veri Toplanma veya İşleme: S.B., A.D.T., Analiz veya Yorumlama: S.B., A.D.T., Literatür Arama: S.B., A.D.T., Yazan: S.B., A.D.T.

Çıkar Çatışması: Yazarlar herhangi bir çıkar çatışması bildirmemişlerdir.

Finansal Destek: Aydın Adnan Menderes Üniversitesi, Bilimsel Araştırma Projeleri Birimi’nden finansal destek alınmıştır (VTF-170065 no’lu proje).


Resimler

  1. Sundar S, Rai M. Laboratory diagnosis of visceral leishmaniasis. Clin Diagn Lab Immunol 2002; 9: 951-8. 
  2. Bakırcı S, Bilgiç HB, Köse O, Aksulu A, Hacılarlıoğlu S, Erdoğan H, et al. Molecular and seroprevalance of canine visceral leishmaniasis in West Anatolia. Turkey. Turk J Vet Anim Sci 2016; 40: 637-44.
  3. Akhoundi M, Downing T, Votýpka J, Kuhls K, Lukeš J, Cannet A, et al. Leishmania infections: Molecular targets and diagnosis. Mol Aspects Med 2017; 57: 1-29. 
  4. Özbilgin A, Töz S, Harman M, Günaştı Topal S, Uzun S, Okudan F, et al. The current clinical and geographical situation of cutaneous leishmaniasis based on species identification in Turkey. Acta Trop 2019; 190: 59-67. 
  5. World Health Organization. Leishmaniasis. https://www.who.int/news-room/fact-sheets/detail/leishmaniasis, 2 March 2020.
  6. Ok UZ, Balcioğlu IC, Taylan Ozkan A, Ozensoy S, Ozbel Y. Leishmaniasis in Turkey. Acta Trop 2002; 84: 43-8. 
  7. Iça A, Inci A, Yildirim A, Atalay O, Düzlü O. Kayseri ve Civarinda Köpeklerde Leishmaniosisin Nested-PCR ile Araştirilmasi [Investigation of canine leishmaniosis by nested-PCR in Kayseri and vicinity]. Turkiye Parazitol Derg 2008; 32: 187-91.
  8. Ordeix L, Dalmau A, Osso M, Llull J, Montserrat-Sangra S, Solano-Gallego L. Histological and parasitological distinctive fndings in clinically-lesioned and normal-looking skin of dogs with diferent clinical stages of leishmaniosis. Parasite Vector 2017; 10: 121.
  9. Atasoy A, Pasa S, Toz SO, Ertabaklar H. Seroprevalence of canine visceral leishmaniasis around the Aegean Cost of Turkey. Kafkas Univ Vet Fak Derg 2010; 16: 1-6.
  10. Abranches P, Silva-Pereira MC, Conceição-Silva FM, Santos-Gomes GM, Janz JG. Canine leishmaniasis: pathological and ecological factors influencing transmission of infection. J Parasitol 1991; 77: 557-61.
  11. le Fichoux Y, Quaranta JF, Aufeuvre JP, Lelievre A, Marty P, Suffia I, et al. Occurrence of Leishmania infantum parasitemia in asymptomatic blood donors living in an area of endemicity in southern France. J Clin Microbiol 1999; 37: 1953-7. 
  12. Gao CH, Ding D, Wang JY, Steverding D, Wang X, Yang YT, et al. Development of a LAMP assay for detection of Leishmania infantum infection in dogs using conjunctival swab samples. Parasit Vectors 2015; 8: 370.
  13. Rohousova I, Talmi-Frank D, Kostalova T, Polanska N, Lestinova T, Kassahun A, Yasur-Landau D, Maia C, King R, Votypka J, Jaffe CL, Warburg A, Hailu A, Volf P, Baneth G. Exposure to Leishmania spp. and sand flies in domestic animals in northwestern Ethiopia. Parasit Vectors 2015; 8: 360.
  14. Brachelente C, Müller N, Doherr MG, Sattler U, Welle M. Cutaneous leishmaniasis in naturally infected dogs is associated with a T helper-2-biased immune response. Vet Pathol 2005; 42: 166-75.
  15. Ozbel Y, Balcioğlu IC, Olgen MK, Simsek FM, Töz SÖ, Ertabaklar H, et al. Spatial distribution of phlebotomine sand flies in the Aydin Mountains and surroundings: the main focus of cutaneous leishmaniasis in western Turkey. J Vector Ecol 2011; 36: 99-105. 
  16. Özbel Y. The infections transmitted by sand flies in Turkey, Ankara Univ Vet Fak Derg 2013; 60: 225-8.
  17. Özbel Y, Karakuş M, Arserim SK, Kalkan ŞO, Töz S. Molecular detection and identification of Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyia dentata in a focus of human and canine leishmaniasis in western Turkey. Acta Trop 2016; 155: 89-94. 
  18. Çetin H, Özbel Y. Kum sinekleri ve Kontrol Yöntemleri. Turkiye Parazitol Derg 2017; 41: 102-13.
  19. Ozensoy Töz S, Sakru N, Ertabaklar H, Demir S, Sengul M, Ozbel Y. Serological and entomological survey of zoonotic visceral leishmaniasis in Denizli Province, Aegean Region, Turkey. New Microbiol 2009; 32: 93-100. 
  20. Pekağırbaş M. Muğla ili ve ilçelerinde bulunan phlebotamine (Diptera:Psychodidae) türleri, popülasyon dinamikleri ve Leishmania türlerinin polimeraz zincir reaksiyon (PCR) yöntemiyle araştırılması (Doktora Tezi). Aydın: Aydın Adnan Menderes Üniv. 2019.
  21. Svobodová M, Alten B, Zídková L, Dvorák V, Hlavacková J, Mysková J, et al. Cutaneous leishmaniasis caused by Leishmania infantum transmitted by Phlebotomus tobbi. Int J Parasitol 2009; 39: 251-6.
  22. World Health Organization. Control of the leishmaniases. World Health Organ Tech Rep Ser 2010; (949): xii-xiii, 1-186, 
  23. Ozbel Y, Oskam L, Ozensoy S, Turgay N, Alkan MZ, Jaffe CL, et al. A survey on canine leishmaniasis in western Turkey by parasite, DNA and antibody detection assays. Acta Trop 2000; 74: 1-6.
  24. Ertabaklar H, Ozensoy S, Sakru N, Keles E, Ozbel Y. Muğla ili Göktepe köyünde çocuklarda ve köpeklerde visceral Leishmaniasis’in araştırılması, Türkiye Parazitol Derg 2001; 25: 128-31.
  25. Toz SO, Korkmaz M, Balcıoglu IC, Ozbel Y, Ertabaklar H. Karaburun ve Urla Bölgesinde Zoonotik Visseral Leishmaniasis, Türkiye Parazitol Derg 2002; 26: 234-8.
  26. Gultekin B, Ertug S, Eren H, Karagenc T, Turgay N, Doyuran ES. Aydın Ili Ketendere Köyünde visseral Leishmaniasis epidemiyolojisi, Türkiye Parazitol Derg 2003; 27: 102-5.
  27. Voyvoda H, Pasa S, Toz SO, Ozbel Y, Ertabaklar H. Prevalence of Leishmania infantum and Dirofilaria immitis infection in dogs in Aydin province and the town of Selcuk, Izmir, Turkey. Turk J Vet Anim Sci 2004; 28: 1105-11.
  28. Toz SO, Culha G, Zeyrek FY, Ertabaklar H, Alkan MZ, Vardarlı AT, et al. A Real-Time ITS1-pcr based method in the diagnosis and species identification of Leishmania parasite from human and dog clinical samples in Turkey. PLoS Negl Trop Dis 2013; 7: e2205.