Özgün Araştırma

Hatay’da Göç Öncesi ve Sonrası Saptanan Kutanöz Leishmaniasis Olgularının Gerçek Zamanlı Polimeraz Zincir Reaksiyonu ile Genotiplendirilmesi

10.4274/tpd.galenos.2020.6650

  • Gülnaz Çulha
  • Tuğba Kaya
  • Asena Çiğdem Doğramacı

Gönderim Tarihi: 05.11.2019 Kabul Tarihi: 27.01.2020 Turkiye Parazitol Derg 2020;44(1):48-51

Amaç:

Türkiye’de Kutanöz Leishmaniasise (KL) sebep olan türler Leishmania tropica (L. tropica) ve Leishmania infantum’dur (L. infantum). Suriye’den diğer ülkelere 2011 yılındaki iç karışıklıktan dolayı büyük bir göç olmuştur. KL’nin endemik olduğu Suriye’den diğer ülkelere olan göçün, KL olgu sayısını ve tür çeşitliliğini etkilediği düşünülmektedir. Çalışmada, arşivde yayma preparatları bulunan KL pozitif, göç öncesi ve sonrası Türk hasta ve importe (Suriye’li) hastalara ait örneklerin tiplendirilmesi ve Hatay’daki göç öncesiyle sonrasındaki KL tür farklılığının ortaya konulması amaçlanmıştır.

Yöntemler:

Çalışmaya arşivde bulunan, dermal kazıntıdan yayma preparatı hazırlanmış, Giemsa boyalı ve mikroskop inceleme ile pozitifliği saptanan toplam 150 hastaya ait (Göç öncesi 50 Türk hasta, göç sonrası 50 Türk hasta ve Suriye’li 50 hasta) preparatlar dahil edilmiştir. Seçilen preparatların DNA izolasyonu yapılmış ve tür tayini için ITS-1problu GZ-PZR analizi yapılmıştır.

Bulgular:

Göç öncesi Türk hastalara ait örneklerin 40’ında L.infantum/donovani (%80), 8’inde L. tropica (%16), 2’sinde L.major (%4) saptanırken, göç sonrası Türk hastalara ait örneklerin ise 28’inde L. infantum/donovani (%56), 3’ünde L. major (%6), 19’unda L. tropica (%38) tespit edilmiştir. Suriye’li hastalara ait örneklerin 2’sinde L. infantum/donovani (%4), 1’inde L. major (%2) ve 47’sinde ise L. tropica (%94) saptanmıştır.

Sonuç:

Hatay’da göç öncesi yerli olgularda çoğunlukla KL’ye neden olan türün L. infantum/donovani olduğu gözlemlenirken, göç sonrası yerli olgularda L. tropica’nın artma eğiliminde olduğu, L. major’a ise geçmiş yıllara göre daha çok rastlandığı görülmektedir. Hatay’a gelen Suriye’lilerin KL etkeni olan Leishmania türlerinde çeşitliliğe neden olabileceği ve konu üzerinde daha ileri araştırmaların yapılması gerektiği sonucuna varılmıştır.

Anahtar Kelimeler: Kutanöz leishmaniasis, göç, gerçek zamanlı-polimeraz zincir reaksiyonu, Hatay

GİRİŞ

Leishmaniasis, enfekte dişi tatarcıkların ısırmasıyla insana bulaşan paraziter bir hastalıktır. Kutanöz, mukokütanöz, visseral olmak üzere üç ana klinik tablo ile karşımıza çıkmaktadır. Kutanöz leishmaniasis (KL), hastalığın en sık karşılan formudur ve genellikle skar oluşarak kendiliğinden iyileşen deri lezyonlarına neden olur. Visseral leishmaniasis (VL) iç organları, etkilemektedir ve tedavi edilmediğinde ölüme sebep olabilmektedir. Mukokütanöz leishmaniasis (MKL) ise mukozayı tutarak tamamen ya da kısmen tahribatına sebep olan önemli bir klinik formdur (1,2). KL ve VL ülkemizde leishmaniasisin en sık görülen klinik formlarıdır ve genel olarak KL’ye L. tropica ve L. infantum, VL’ye ise L. infantum neden olmaktadır (3). VL Ege, Akdeniz ve İç Anadolu Bölgeleri’nde, KL ise Güneydoğu Anadolu Bölgesi başta olmak üzere Akdeniz, İç Anadolu ve Ege Bölgesi’nde görülmektedir (4-6). Türkiye’de 1990-2010 yılları arasında toplam 46.003 KL olgusunun olduğu bildirilmiştir (3). 2011 yılı Nisan ayında, Suriye’de yaşanan iç karışıklık nedeniyle yaklaşık 300-400 kişi Hatay ili Cilvegözü sınır kapısından giriş yapmış ve ilk sığınma kamplarına yerleşmişlerdir. İlimizde ilk yıl Altınözü, Yayladağı, Reyhan'lı da toplam beş kamp kurulmuştur (7). Ancak bugün itibariyle 10 ilimizde (başta Hatay, Şanlıurfa, Gaziantep olmak üzere) oluşturulmuş kamplar dışında 81 ilimizde 4 milyona yakın Suriye'li olduğu tahmin edilmektedir (4,7). Bu durum ülkemizin hemen hemen her yerinde importe KL olgularının görülmesine neden olmuştur. Göç sonrası 2013 yılında Türkiye’de Türk ve Suriyeli toplam KL olgu sayısı 5.362 ile son yılların en yüksek sayısına ulaşmıştır. 2015-2017 yılları arasında yıllık ortalama 2000-2.500 olgu görüldüğü Sağlık Bakanlığı tarafından bildirilmiştir (8).

Ülkemizde KL’nin en sık görülen türleri Leishmania tropica (L. tropica) ve Leishmania infantum'dur (L. infantum). Ancak 2010 yılı sonrası yapılan çalışmalarda Leishmania major (L. major) ve Leishmania donovani’nin (L. donovani) de KL’ye neden olan türler olduğu gösterilmiştir (9). Göç öncesi yapılan bir çalışmada, L. infantum’un Hatay ilinde KL’ye sebep olan türlerin başında geldiği saptanmıştır (10). Göç sonrası yapılan çalışmalarda ise L. infantum ile birlikte L. tropica ve L. major’unda Hatay’da KL’ye neden olan türler olduğu tespit edilmiştir (11,12). Suriye’de ise bildirilen KL olgularının büyük çoğunluğunun L. tropica kaynaklı olduğu ve geri kalan olguların ise L. major tarafından oluşturulduğu bilinmektedir (13).

Çalışmada, Hatay’da göç öncesi ve sonrası yerli (Türk hasta) ve importe (Suriye'li hasta) KL hastalara ait smear örnekleri arşivden seçilerek moleküler yöntem (GZ-PZR) ile tiplendirilmiş ve ilimizdeki göç öncesi ve sonrası KL tür farklılığının ortaya konulması amaçlanmıştır.


YÖNTEMLER

Çalışmada; dermal kazıntı materyalinden yayma preparatı yapılmış, Giemsa boyama yöntemi ile boyanmış ve mikroskop (100 X immersiyon) ile incelemesinde Leishmania parazitinin amastigot formunun varlığı tespit edilmiş toplam 150 hastaya ait (göç öncesi 50 Türk hasta, göç sonrası 50 Türk hasta ve Suriyeli 50 hasta) preparatlar arşivden seçilmiştir. Seçilen örneklerin yayma preparatları liziz tamponu ile yıkanmış ve DNA izolasyon kiti (QIAamp DNA Mini Kit, Qıagen, Almanya) içerisinde bulunan protokole uygun olarak çalışılmıştır.

Örneklerde tür tayini yapabilmek için ITS1 problu GZ-PZR ile çalışılmıştır. Leishmania parazitlerinin ssu rRNA ve 5,8S rRNA’yı kodlayan genleri ayıran ribozomal internal transcribed spacer 1 (ITS1) bölgesi, Forward primer; 5’-CTGGATCATTTTCCGATG-3’, Reverse Primer; 5’-GAAGCCAAGTCATCCATCGC-3’ primerleri ile birlikte Probe 1: 5’- CCGTTTATACAAAAAATATACGGCGTTTCGGTTTFluo-3’, Probe 2: 5’-LCRed-640-GCGGGGTGGGTGCGTGTGTG-Pho-3’ özgün problar kullanılmıştır. PZR analizi için 1,5 µL H20 (PCR grade water), 1 µL Forward Primer, 1 µL Reverse Primer, 0,5 µL Probe1, 0,5 µL Probe2, 12,5 µL QuantiTect Probe PCR Kit Master karışımı (Qiagen) ve 5 µL genomik DNA olmak üzere toplam hacmi 25 µL olan karışım hazırlanmıştır (14,15). Rotor-Gene cihazında melting analizi yapılarak tiplendirme yapılmıştır.


BULGULAR

Göç öncesi ve sonrasına ait seçilen Türk örneklerin kayıtlarına bakıldığında hastaların Altınözü, Hassa, Kırıkhan, Yayladağ, Samandağ gibi Hatay’da KL’nin sık olarak görüldüğü bölgelerden geldiği saptanmıştır. Göç öncesi yıllara ait seçilen preparatların GZ-PZR testi sonucunda 50 Türk örneğin 40’ının (%80) L. infantum/donovani, 8’inin (%16) L. tropica, 2’sinin (%4) L. major olduğu tespit edilmiştir. Göç sonrası seçilen 50 Türk örneğin ise 28’inin (%56) L. infantum/donovani, 3’ünün (%6) L. major, 19’unun (%38) L. tropica olduğu saptanmıştır. Suriye'li hastalara ait kayıtlarda daha çok İdlip, Halep, Hama gibi Suriye’nin KL açısından endemik olduğu bilinen bölgelerden geldiği tespit edilmiştir. Elli Suriyeli hasta örneğinin 2’si (%4) L. infantum/donovani, 1’i (%2) L. major ve 47’si (%94) ise L. tropica olarak tiplendirilmiştir (Şekil 1, 2).


TARTIŞMA

Türkiye’de KL halk sağlığı sorunu olarak güncelliğini korumaya devam etmektedir. KL, Phlebotomus (halk arasında yakarca, kum sineği, tatarcık olarak bilinen) cinsi vektör ile bulaşan önemli parazit hastalıklardan biridir. Phlebotomus sergenti ve Phlebotomus papatasi KL’nin bulaşmasında vektör olarak rol oynayan türlerdir (16). Hatay ili ile Suriye sınırı arası 46 km yakınlıktadır. Hatay’da, KL’nin endemik olan bazı köyleri (Kıyıgören, Meydan, Yuvalı, Alahan Köyü) Suriye’ye yakın bir konumda yer almaktadır (17). Göç öncesi, Hatay’dan özellikle KL’nin endemik olduğu Suriye’nin Halep, Laskiye kentine turistik amaçlı günlük gidiş ve gelişlerin çok olması, taşımacılık yapan şoförler ile mevsimlik olarak çalışmaya gelen işçiler gibi çeşitli faktörler KL sayısının artma nedenleri arasında yer almaktadır (18). Çulha ve ark. (19) 2018 yılında, yakın komşumuz olan Suriye dahil Azerbaycan, Özbekistan, Türkmenistan, İran, Irak gibi ülkelere giden ve döndükten sonra KL tanısı alan tır şoförlerinde, etken türler L. tropica, L.infantum/donovani, L. major olarak tiplendirmişlerdir.

KL açısından endemik olan Hatay ilinde, 1994-2004 yılları arasında 1079 KL olgusu bildirilmiştir (18). 2006-2011 yılları arasında ise 535 olgunun bildirimi yapılmış ve daha çok Hassa, Altınözü, Samandağ,  Reyhanlı, İskenderun, Kırıkhan gibi endemik ilçelerinden olduğu belirtilmiştir (19). Hatay'da KL’nin vektörleri; Phlebotomus sergenti, Phlebotomus papatasi, Phlebotomus syriacus’dur (16). Göç öncesi yıllara ait çalışmalarda Hatay’da, genel olarak L. infantum olmak üzere L. tropica’nın da KL etkeni olduğu gösterilmiştir (10,11). Çalışmamızda da göç öncesi yerli olgulara ait 50 örneğin 40’ı L. infantum/donovani, 8’i L. tropica, 2’si L. major olarak tiplendirilmiştir.

Dünya Sağlık Örgütü’nün verilerine göre, Suriye’de 2010 yılında 42.165 KL olgusu varken, 2014 yılında 55.204 KL olgusu olduğu bildirilmiştir. Suriye’de KL’nin büyük bir çoğunluğunda etken olan tür L. tropica olduğu ve daha çok Halep, İdlip, Hama, Lazkiye ve Tartus’ta görüldüğü bilinmektedir. L. major ise Al-Hasakah, Şam ve Deir ez-Zour’a yakın kırsal alanlarda görülmektedir (20).

Suriye’deki göçün büyük bir kısmı Türkiye, Lübnan ve Ürdün’e olmuştur. Lübnan’da 2000-2012 yılları arasında 6 KL olgusu olduğu ancak 2013 yılında büyük bir kısmını Suriye'lilerin olduğu toplam 1033 olgu ile çok büyük bir artış olduğu bildirilmiştir (21). Saroufim ve ark. (22) Lübnan’da yaşayan 948 KL şüpheli Suriyeli hastanın %85’ini L. tropica, %15’ini L. major olarak tiplendirmişler.  

Ürdün’de, Haziran 2017’de 660.000’dan fazla Suriyeli olduğu kaydedilmiş ve 2010-2016 yılları arasında 1243 KL tanılı hastanın 559’unun Suriyeli hastalar olduğu bildirilmiştir (23). Hijawi ve ark. Ürdün’de 66 KL hastasından (39 Ürdün ve 27 Suriyeli) aldıkları örneklerin 29’unu moleküler yöntemlerle (ITS1-PCR-RFLP, Nested ITS1-5.8S rDNA PCR ve  kDNA PCR) tiplendirmişler ve  ITS-1 PZR-RFLP ile 20’sini L. major, 9’unu L. tropica olarak bulmuşlardır. Çalışma da ülkedeki Suriye'li KL hastalarının Leishmania tür geçişinin üzerindeki etkisinin daha detaylı bir şekilde araştırılmasının gerektiği vurgulanmıştır (24).

Türkiye’ye 2011-2019 tarihleri arasında yaklaşık 4 milyona yakın Suriyeli’nin göç ettiği tahmin edilmektedir. En çok göç alan illerimiz ise İstanbul, Gaziantep, Hatay, Şanlıurfa, Mersin’dir (7). Sağlık Bakanlığı verilerine göre, ülkemizde hem Suriyeli hem de yerli olgu sayısı yıllık 1500-2000 arasında değişmektedir (8).

Türkiye’de KL’ye neden olan başlıca türler L. tropica ve özellikle Doğu Akdeniz Bölgesi’nde görülen L. infantum’dur. Ancak son yıllarda L. major ve L. donovani’nin etken türler olduğu gösterilmiştir (6). 2009 yılında Toz ve ark. (10) Türkiye’de KL’den sorumlu olan türün L.tropica,  Hatay ilinde ise etkenin L. infantum olduğunu bildirmişlerdir. 2016 yılında ise Özbilgin ve ark. (12) Antalya, Adana, Hatay, Mardin, Diyarbakır, Şanlıurfa, Bitlis, Manisa, Burdur illerinde toplam 18 KL tanılı hastada L. major saptamışlardır. (Aynı araştırıcı 2019 yılında,18 ilde 356 KL tanılı hastadan aldıkları örneklerin; 299’unu L. tropica, 28’ini L. major, 19’unu L. infantum ve 10’unu L. donovani olarak tiplendirmişlerdir. Hatay’dan alınan 2 örnek L. infantum ve L. tropica olarak tanımlanmıştır. L. infantum ile L. major KL olgularının sayısında bir artış olduğunu bildirmişlerdir (9).

Şanlıurfa’da uzun yıllar L. tropica’nın KL’ye neden olan tek tür olduğu bilinmektedir (25). Ancak göç sonrası 2014 yılında Zeyrek ve ark. (25,26) biri importe olmak üzere üç L. major olgusu saptamışlar ve 2018 yılında ise Gürses ve ark Şanlıurfa’da yaptığı bir çalışmada ise 135 KL tanılı hastanın 132’sini L. tropica, 3’ünü ise L.major olarak tiplendirmişledir. Şanlıurfa’da göç sonrası yıllarda yapılan çalışmalarda L. major’un görülmesine paralel olarak bizim çalışmamızda da göç sonrası yıllarda L. tropica’nın etken olduğu KL sayılarında artış olduğu gözlemlenmiştir.


SONUÇ

Göç öncesi ilimizde daha çok KL etkeni olarak L.infantum sorumlu iken göç sonrası yerli olgularda L.tropica’nın yükselme eğiliminde olduğu, L. major’un ise ülke genelinde olduğu gibi ilimizde de geçmiş yıllara oranla daha çok rastlandığı görülmektedir. Bu nedenle, göçün Leishmania tür geçişinin üzerinde etkili olabileceği sonucuna varılmıştır.

İl Sağlık Müdürlükleri ile birlikte ve üniversiteler arasında bu konu üzerinde koordineli bir çalışma yapılmasının ve düzenli vektör kontrol programlarının oluşturulmasının önemli olduğu ve bu konu ile ilgili daha geniş kapsamlı çalışmalarının yapılması düşüncesindeyiz.

TEŞEKKÜR

Teşekkür: Prof. Dr. Ahmet Özbilgin’e, Celal Bayar Üniversitesi Tıp Fakültesi Parazitoloji Anabilim Dalı Parazit Bankası’ndan referans suşların temin edilmesinde sağladığı katkılardan dolayı teşekkür ederiz.

* Etik

Etik Kurul Onayı: Hatay Mustafa Kemal Üniversitesi Tıp Fakültesi Girişimsel Olmayan Klinik Araştırmalar Etik Kurulu’ndan çalışma için onay alınmıştır. (Araştırmanın Protokol Kodu:17/12/2018-02-9).

Hasta Onayı:

Hakem Değerlendirmesi: Editörler kurulu ve editörler kurulu dışında olan kişiler tarafından değerlendirilmiştir.

* Yazarlık Katkıları

Dizayn: G.Ç., Veri Toplama veya İşleme:  G.Ç., T.K., Analiz veya Yorumlama: G.Ç., T.K., A.Ç.D., Literatür Arama: G.Ç., T.K., A.Ç.D.,Yazan: G.Ç., T.K.

Çıkar Çatışması: Yazarlar tarafından çıkar çatışması bildirilmemiştir.

Finansal Destek: Yazarlar tarafından finansal destek almadıkları bildirilmiştir.

Bildiri: Bu çalışma 28 Eylül-03 Ekim tarihleri arasında Çeşme/İzmir’de yapılan 21. Parazitoloji Kongre'sinde poster olarak sunulmuştur.


Resimler

  1. Özbel Y, Özensoy Töz S. Leishmaniasis. Özcel MA, Özbel Y, Ak M, editors. Özcel’in Tıbbi Parazit Hastalıkları Kitabı. Türkiye Parazitoloji Derneği Yayını, No: 22; 2007. p. 197-244.
  2. https://www.who.int/leishmaniasis/disease/en/
  3. Özbilgin A, Çulha G, Uzun S, Harman M, Topal SG, Okudan F, et al. Leishmaniasis in Turkey: first clinical isolation of Leishmania major from 18 autochthonous cases of cutaneous leishmaniasis in four geographical regions. Trop Med Int Health 2016; 21: 783-91.
  4. Uzun S, Gürel MS, Harman M. Kutanöz Layşmanyazis Tanı ve Tedavi Rehberi. Türk Dermatoloji Derneği, Haziran 2017. Galenos Yayınevi, İstanbul, Türkiye.
  5. Ok UZ, Balcioğlu IC, Taylan Ozkan A, Ozensoy S, Ozbel Y. Leishmaniasis in Turkey. Acta Trop 2002; 84: 43-8.
  6. Gürel MS, Yeşilova Y, Ölgen MK, Özbel Y. Türkiye’de kutanöz leishmaniasisin durumu. Türkiye Parazitol Derg 2012; 36: 121-9.
  7. https://www.goc.gov.tr/turkiye-de-gecici-koruma 
  8. https://hsgm.saglik.gov.tr/tr/zoonotikvektorel-sarkcibani/istatistik
  9. Özbilgin A, Töz S, Harman M, Günaştı Topal S, Uzun S, Okudan F, et al. The current clinical and geographical situation of cutaneous leishmaniasis based on species identification in Turkey. Acta Trop 2019; 190: 59-67.
  10. Toz SO, Nasereddin A, Ozbel Y, Ertabaklar H, Culha G, Sevil N, et al. Leishmaniasis in Turkey: molecular characterization of Leishmania from human and canine clinical samples. Trop Med Int Health 2009; 14: 1401-6.
  11. Culha G, Akyar I, Yildiz Zeyrek F, Kurt Ö, Gündüz C, Özensoy Töz S, et al. Leishmaniasis in Turkey: Determination of Leishmania Species by Matrix-Assisted Laser Desorption Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF MS). Iran J Parasitol 2014; 9: 239-48.
  12. Özbilgin A, Çulha G, Uzun S, Harman M, Topal SG, Okudan F, Zeyrek F, Gündüz C, Östan İ, Karakuş M, Töz S, Kurt Ö, Akyar I, Erat A, Güngör D, Kayabaşı Ç, Çavuş İ, Bastien P, Pratlong F, Kocagöz T, Özbel Y. Leishmaniasis in Turkey: first clinical isolation of Leishmania major from 18 autochthonous cases of cutaneous leishmaniasis in four geographical regions. Trop Med Int Health 2016; 21: 783-91.
  13. Haddad N, Saliba H, Altawil A, Villinsky J, Al-Nahhas S. Cutaneous leishmaniasis in the central provinces of Hama and Edlib in Syria: Vector identification and parasite typing. Parasit Vectors 2015; 8: 524.
  14. Özbilgin A, Çavuş İ, Yıldırım A, Kaya T, Ertabaklar H. Leishmania tropica Üzerinde In vitro ve In vivo İlaç Etkinliğinin Değerlendirilmesi: Pilot Çalışma. Türkiye Parazitolojii Dergisi 2018; 42: 11.
  15. Toz SO, Culha G, Zeyrek FY, Ertabaklar H, Alkan MZ, Vardarlı AT, et al. A real-time ITS1-PCR based method in the diagnosis and species identification of Leishmania parasite from human and dog clinical samples in Turkey. PLoS Negl Trop Dis 2013; 7: e2205.
  16. Yaman M, Ozbel Y. The sandflies (Diptera: Psychodidae) in the Turkish province of Hatay: some possible vectors of the parasites causing human cutaneous leishmaniasis. Ann Trop Med Parasitol 2004; 98: 741-50.
  17. Çulha G, Doğramacı ÇA, Gülkan B, Savaş N. (Kutanöz leishmaniasis ve Hatay İlindeki durumu. Türk Hijyen ve Deneysel Biyoloji Dergisi 2014; 71: 171-8.
  18. Çulha G,  Akçalı C. Hatay ve çevresinde saptanan kutanöz leishmaniasis olguları. Türkiye Parazitol Derg 2006; 30: 268-71.
  19. Çulha G, Doğramacı AÇ, Kaya T, Çavuş İ, Gülkan B, Özbilgin A. Imported cutaneous leishmaniasis cases detected in truck drivers in Hatay. Mikrobiyol Bul 2018; 52: 316-23.
  20. https://www.who.int/leishmaniasis/burden/Leishmaniasis_Syrian_Arab_Republic/en/.
  21. Al-Salem WS, Pigott DM, Subramaniam K, Haines LR, Kelly-Hope L, Molyneux DH, et al. Cutaneous leishmaniasis and conflict in Syria. Emerg Infect Dis 2016; 22: 931-3.
  22. Saroufim M, Charafeddine K, Issa G, Khalifeh H, Habib RH, Berry A, et al. Ongoing epidemic of cutaneous leishmaniasis among Syrian refugees, Lebanon. Emerg Infect Dis 2014; 20: 1712-5.
  23. Kanani K, Amr ZS, Shadfan B, Khorma R, Rø G, Abid M, et al. Cutaneous leishmaniasis among Syrian refugees in Jordan. Acta tropica 2019; 194: 169-71.
  24. Hijawi KJ, Hijjawi NS,  Ibbini JH. (2019). Detection, genotyping, and phylogenetic analysis of Leishmania isolates collected from infected Jordanian residents and Syrian refugees who suffered from cutaneous leishmaniasis. Parasitol Res 2019; 118: 793-805.
  25. Gurses G, Ozaslan M, Zeyrek FY, Kılıç IH, Doni NY, Karagöz ID, et al. Molecular identification of Leishmania spp. isolates causes cutaneous leishmaniasis (CL) in Sanliurfa Province, Turkey, where CL is highly endemic. Folia Microbiol (Praha) 2018; 63: 353-9.
  26. Zeyrek FY, Gürses G, Uluca N, Yentür Doni N, Toprak Ş, Yeşilova Y, et al. Is the agent of cutaneous leishmaniasis in Sanliurfa changing? First cases of Leishmania major. Turkiye Parazitol Derg 2014; 38: 270-4.
  27. https://www.lafsozluk.com/2009/03/hatay-ilinin-ilceleri-ve-nufus-sayilari.html